ID: 922857308

View in Genome Browser
Species Human (GRCh38)
Location 1:228785920-228785942
Sequence GGAGGCTGAACAGTGATGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922857308_922857310 -8 Left 922857308 1:228785920-228785942 CCACGCATCACTGTTCAGCCTCC No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data
922857308_922857309 -9 Left 922857308 1:228785920-228785942 CCACGCATCACTGTTCAGCCTCC No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data
922857308_922857316 15 Left 922857308 1:228785920-228785942 CCACGCATCACTGTTCAGCCTCC No data
Right 922857316 1:228785958-228785980 CCTACACTTTCTCGCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922857308 Original CRISPR GGAGGCTGAACAGTGATGCG TGG (reversed) Intergenic