ID: 922857309

View in Genome Browser
Species Human (GRCh38)
Location 1:228785934-228785956
Sequence TCAGCCTCCTCCTTAGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922857307_922857309 -4 Left 922857307 1:228785915-228785937 CCACACCACGCATCACTGTTCAG No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data
922857303_922857309 25 Left 922857303 1:228785886-228785908 CCCCGTCAAGCGTCTCTGCCATG No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data
922857308_922857309 -9 Left 922857308 1:228785920-228785942 CCACGCATCACTGTTCAGCCTCC No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data
922857305_922857309 23 Left 922857305 1:228785888-228785910 CCGTCAAGCGTCTCTGCCATGAT No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data
922857306_922857309 7 Left 922857306 1:228785904-228785926 CCATGATGTAGCCACACCACGCA No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data
922857304_922857309 24 Left 922857304 1:228785887-228785909 CCCGTCAAGCGTCTCTGCCATGA No data
Right 922857309 1:228785934-228785956 TCAGCCTCCTCCTTAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922857309 Original CRISPR TCAGCCTCCTCCTTAGCACC AGG Intergenic
No off target data available for this crispr