ID: 922857310

View in Genome Browser
Species Human (GRCh38)
Location 1:228785935-228785957
Sequence CAGCCTCCTCCTTAGCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922857308_922857310 -8 Left 922857308 1:228785920-228785942 CCACGCATCACTGTTCAGCCTCC No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data
922857305_922857310 24 Left 922857305 1:228785888-228785910 CCGTCAAGCGTCTCTGCCATGAT No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data
922857306_922857310 8 Left 922857306 1:228785904-228785926 CCATGATGTAGCCACACCACGCA No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data
922857304_922857310 25 Left 922857304 1:228785887-228785909 CCCGTCAAGCGTCTCTGCCATGA No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data
922857303_922857310 26 Left 922857303 1:228785886-228785908 CCCCGTCAAGCGTCTCTGCCATG No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data
922857307_922857310 -3 Left 922857307 1:228785915-228785937 CCACACCACGCATCACTGTTCAG No data
Right 922857310 1:228785935-228785957 CAGCCTCCTCCTTAGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922857310 Original CRISPR CAGCCTCCTCCTTAGCACCA GGG Intergenic
No off target data available for this crispr