ID: 922857311

View in Genome Browser
Species Human (GRCh38)
Location 1:228785938-228785960
Sequence AGGCCCTGGTGCTAAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922857311_922857316 -3 Left 922857311 1:228785938-228785960 CCTCCTCCTTAGCACCAGGGCCT No data
Right 922857316 1:228785958-228785980 CCTACACTTTCTCGCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922857311 Original CRISPR AGGCCCTGGTGCTAAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr