ID: 922857312

View in Genome Browser
Species Human (GRCh38)
Location 1:228785941-228785963
Sequence TGTAGGCCCTGGTGCTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922857312_922857316 -6 Left 922857312 1:228785941-228785963 CCTCCTTAGCACCAGGGCCTACA No data
Right 922857316 1:228785958-228785980 CCTACACTTTCTCGCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922857312 Original CRISPR TGTAGGCCCTGGTGCTAAGG AGG (reversed) Intergenic
No off target data available for this crispr