ID: 922857316

View in Genome Browser
Species Human (GRCh38)
Location 1:228785958-228785980
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922857308_922857316 15 Left 922857308 1:228785920-228785942 CCACGCATCACTGTTCAGCCTCC No data
Right 922857316 1:228785958-228785980 CCTACACTTTCTCGCAGCCTAGG No data
922857307_922857316 20 Left 922857307 1:228785915-228785937 CCACACCACGCATCACTGTTCAG No data
Right 922857316 1:228785958-228785980 CCTACACTTTCTCGCAGCCTAGG No data
922857312_922857316 -6 Left 922857312 1:228785941-228785963 CCTCCTTAGCACCAGGGCCTACA No data
Right 922857316 1:228785958-228785980 CCTACACTTTCTCGCAGCCTAGG No data
922857313_922857316 -9 Left 922857313 1:228785944-228785966 CCTTAGCACCAGGGCCTACACTT No data
Right 922857316 1:228785958-228785980 CCTACACTTTCTCGCAGCCTAGG No data
922857311_922857316 -3 Left 922857311 1:228785938-228785960 CCTCCTCCTTAGCACCAGGGCCT No data
Right 922857316 1:228785958-228785980 CCTACACTTTCTCGCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type