ID: 922861334

View in Genome Browser
Species Human (GRCh38)
Location 1:228818835-228818857
Sequence TCCTGTCCTCTGCCCTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922861334_922861336 -6 Left 922861334 1:228818835-228818857 CCAGAGCAGGGCAGAGGACAGGA No data
Right 922861336 1:228818852-228818874 ACAGGAGAGGATGAAGACATTGG No data
922861334_922861337 6 Left 922861334 1:228818835-228818857 CCAGAGCAGGGCAGAGGACAGGA No data
Right 922861337 1:228818864-228818886 GAAGACATTGGAGAGAAGACTGG No data
922861334_922861338 10 Left 922861334 1:228818835-228818857 CCAGAGCAGGGCAGAGGACAGGA No data
Right 922861338 1:228818868-228818890 ACATTGGAGAGAAGACTGGATGG No data
922861334_922861339 25 Left 922861334 1:228818835-228818857 CCAGAGCAGGGCAGAGGACAGGA No data
Right 922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922861334 Original CRISPR TCCTGTCCTCTGCCCTGCTC TGG (reversed) Intergenic
No off target data available for this crispr