ID: 922861339

View in Genome Browser
Species Human (GRCh38)
Location 1:228818883-228818905
Sequence CTGGATGGCCAGCAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922861334_922861339 25 Left 922861334 1:228818835-228818857 CCAGAGCAGGGCAGAGGACAGGA No data
Right 922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922861339 Original CRISPR CTGGATGGCCAGCAGCAGAG AGG Intergenic
No off target data available for this crispr