ID: 922864985

View in Genome Browser
Species Human (GRCh38)
Location 1:228852227-228852249
Sequence GCCAGGGAGCCCTTCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864985_922864996 21 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC No data
Right 922864996 1:228852271-228852293 CACTGGTAGGAGTGCACGCTGGG No data
922864985_922864992 4 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC No data
Right 922864992 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
922864985_922864987 -8 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC No data
Right 922864987 1:228852242-228852264 TCCCTGGCAGGCCCTCTGACTGG No data
922864985_922864997 22 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC No data
Right 922864997 1:228852272-228852294 ACTGGTAGGAGTGCACGCTGGGG No data
922864985_922864998 25 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC No data
Right 922864998 1:228852275-228852297 GGTAGGAGTGCACGCTGGGGTGG No data
922864985_922864995 20 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC No data
Right 922864995 1:228852270-228852292 GCACTGGTAGGAGTGCACGCTGG No data
922864985_922864993 8 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC No data
Right 922864993 1:228852258-228852280 TGACTGGCCTGTGCACTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922864985 Original CRISPR GCCAGGGAGCCCTTCCCACC TGG (reversed) Intergenic