ID: 922864985

View in Genome Browser
Species Human (GRCh38)
Location 1:228852227-228852249
Sequence GCCAGGGAGCCCTTCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 14, 1: 16, 2: 28, 3: 92, 4: 338}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864985_922864998 25 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC 0: 14
1: 16
2: 28
3: 92
4: 338
Right 922864998 1:228852275-228852297 GGTAGGAGTGCACGCTGGGGTGG No data
922864985_922864996 21 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC 0: 14
1: 16
2: 28
3: 92
4: 338
Right 922864996 1:228852271-228852293 CACTGGTAGGAGTGCACGCTGGG No data
922864985_922864995 20 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC 0: 14
1: 16
2: 28
3: 92
4: 338
Right 922864995 1:228852270-228852292 GCACTGGTAGGAGTGCACGCTGG No data
922864985_922864993 8 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC 0: 14
1: 16
2: 28
3: 92
4: 338
Right 922864993 1:228852258-228852280 TGACTGGCCTGTGCACTGGTAGG No data
922864985_922864987 -8 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC 0: 14
1: 16
2: 28
3: 92
4: 338
Right 922864987 1:228852242-228852264 TCCCTGGCAGGCCCTCTGACTGG No data
922864985_922864992 4 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC 0: 14
1: 16
2: 28
3: 92
4: 338
Right 922864992 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
922864985_922864997 22 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC 0: 14
1: 16
2: 28
3: 92
4: 338
Right 922864997 1:228852272-228852294 ACTGGTAGGAGTGCACGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922864985 Original CRISPR GCCAGGGAGCCCTTCCCACC TGG (reversed) Intergenic
900342204 1:2194578-2194600 GGCAGGGAGCCCTCCCCAGGGGG + Intronic
900359810 1:2283098-2283120 GCCAGGGAGGCGCCCCCACCCGG + Intronic
900396925 1:2456888-2456910 ACCTGGGGTCCCTTCCCACCTGG - Intronic
900643716 1:3699240-3699262 GGAAGAGAGCCCATCCCACCAGG - Intronic
900955298 1:5883018-5883040 GCCTGAGTGCCCTTCTCACCGGG - Intronic
901988842 1:13096116-13096138 GCCAGGGAGCCCCTGCCGGCAGG - Intergenic
901992971 1:13130651-13130673 GCCAGGGAGCCCCTGCCGGCAGG + Intergenic
902039667 1:13483573-13483595 TCCAGGGAGCCCTTCTGACAAGG - Intronic
902264845 1:15255951-15255973 GCCAGGGAGCCCATTTCAACAGG - Intronic
903213848 1:21832553-21832575 CCCAGGGAGCCCCACCAACCTGG - Exonic
903326878 1:22573885-22573907 GCCTGGGAGTCTTGCCCACCTGG + Intronic
903370233 1:22830514-22830536 GCCAGGTATCCCTTGCCTCCTGG - Intronic
903887372 1:26548225-26548247 GCCTGTGAGCCCTTCACAGCAGG - Intronic
904849505 1:33446776-33446798 GCCAGGAATCCCCTCCCTCCTGG - Intergenic
905455574 1:38085846-38085868 TCCAGGAAGCCCTTCCTACCAGG - Intergenic
905866054 1:41377405-41377427 GCCAGGGAGCCCAGCCCCCAGGG - Intronic
906750038 1:48250708-48250730 GCCAGGGAGCCCTTCCCACCTGG - Intergenic
908260999 1:62339156-62339178 GCCAGGGACCCCTCTCCAACTGG + Intergenic
909092651 1:71245944-71245966 GCCATGGAGGCCTTCCTCCCTGG - Intergenic
909736787 1:78971385-78971407 TCCAGGGAGCCATTCCCACCTGG - Intronic
909863086 1:80633359-80633381 TCCAGGGACCCCCTCCCACCTGG - Intergenic
910447371 1:87312412-87312434 GCCAGGGAGGCCTTGCTACTGGG + Intergenic
912080850 1:105933938-105933960 GCCAGGGAGTCCTCCCCACCTGG - Intergenic
912254698 1:108046999-108047021 CACAGCCAGCCCTTCCCACCTGG + Intergenic
912554842 1:110508466-110508488 CTCCGGGAGCCCTGCCCACCAGG + Intergenic
913285775 1:117225108-117225130 GCTGGGGAGCCCATCTCACCAGG - Intergenic
915544884 1:156591638-156591660 GCTGGGGAGCAGTTCCCACCCGG - Intergenic
915751122 1:158212419-158212441 GCCTGGGAGCAGGTCCCACCTGG - Intergenic
915823991 1:159056350-159056372 TCTGGGGACCCCTTCCCACCTGG + Intergenic
916324296 1:163540173-163540195 GCCTGGAAGCCCTTCCCATCTGG - Intergenic
917977741 1:180251087-180251109 GCCAGGTGGGCCTTCCCGCCAGG + Intronic
918282779 1:183023047-183023069 GCGAGGCCGCCCTTCCCTCCCGG + Intergenic
919258559 1:195158338-195158360 TCCAGGGAGCCCCTCCCACCTGG + Intergenic
919757327 1:201074232-201074254 GCAGGGGAGCCCTGCCCAACTGG + Intronic
921945995 1:220886605-220886627 GCCAGGGCAGCCTCCCCACCTGG + Intergenic
922002577 1:221494891-221494913 TCCAGGGAGCCCTTCCCACCAGG + Intergenic
922086833 1:222357344-222357366 GTCAGGGAGCCCTTCCCACCTGG - Intergenic
922864985 1:228852227-228852249 GCCAGGGAGCCCTTCCCACCTGG - Intergenic
923003873 1:230029520-230029542 TCTGGGGACCCCTTCCCACCTGG + Intergenic
923913856 1:238481454-238481476 TCCAGAGACCCCCTCCCACCTGG + Intergenic
924625689 1:245695081-245695103 GCCAGGGATCCCCTCCTTCCAGG - Intronic
924865684 1:247977679-247977701 GTCAGGTAGCCCTTCTCACAGGG + Intronic
1063030109 10:2225862-2225884 GCCCAGGAGCCCTTCCAACCTGG + Intergenic
1064334136 10:14423240-14423262 GCCAGGAAACCCTTCCAACCTGG - Intronic
1065152050 10:22831815-22831837 TCCAGGGATCCCCTCCCACCTGG + Intergenic
1065643865 10:27814340-27814362 TCTGGGGACCCCTTCCCACCCGG + Intronic
1067041352 10:42954899-42954921 GCCAGGCACTGCTTCCCACCAGG + Intergenic
1067044771 10:42979286-42979308 CCCAGGGATCCCTTCCCCTCAGG - Intergenic
1067180136 10:43979146-43979168 TCCAGGAACCCCCTCCCACCTGG + Intergenic
1067566950 10:47346315-47346337 GCCAGGGTGTCCTTGCCCCCAGG - Intergenic
1069197385 10:65570395-65570417 TCCAGGGACCCCCTCCCACCTGG - Intergenic
1069316296 10:67107739-67107761 GCCAGGGACCCCCTCACACCTGG - Intronic
1070156153 10:73836819-73836841 GCCAAGCAGCCATTCCCAGCAGG + Intronic
1070820364 10:79350670-79350692 GCCAGGGAGCCCTCCCGCGCTGG - Intronic
1071236604 10:83657232-83657254 GCCAGGGTGGCCTTGGCACCTGG + Intergenic
1071468338 10:85961025-85961047 GCCCTGGAGCCCTTCACTCCAGG - Intronic
1071907404 10:90188735-90188757 GCCAGGGAGCCCTTCTCACCTGG + Intergenic
1071926557 10:90416006-90416028 TCCAGGGACCCCCTCCCACCTGG - Intergenic
1072015038 10:91338272-91338294 GCCAGGGACCCTCTCTCACCTGG - Intergenic
1075452186 10:122558942-122558964 GGCAGGGAGCCTTCCCCTCCAGG - Intergenic
1075629931 10:123994747-123994769 GCCAGGAAGCCTTTCCCTCCCGG - Intergenic
1075648675 10:124113173-124113195 GGCAGGAAGCCCCTCCCATCAGG + Intergenic
1075913878 10:126149253-126149275 GCCCTGGAGCCCTTCCATCCGGG + Intronic
1076783133 10:132735459-132735481 CCCAGGGCGCCCGTGCCACCGGG - Intronic
1076812254 10:132893325-132893347 TCTGGGGACCCCTTCCCACCTGG - Intronic
1077025509 11:438204-438226 GACAGGGAGCCCTCCCCCCAGGG + Intronic
1077540827 11:3145750-3145772 GCCAGGCCCCACTTCCCACCAGG - Intronic
1078566349 11:12417899-12417921 GCCAGGGAGCACCTCCTACAAGG + Intronic
1078680978 11:13475358-13475380 TCTGGGGACCCCTTCCCACCTGG + Intergenic
1079762325 11:24344504-24344526 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1081779541 11:45700428-45700450 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1082735484 11:56851067-56851089 GCCAGGGAGTCCTTCTCACCTGG - Intergenic
1083457289 11:62787414-62787436 GCCATGGCGCCCTGACCACCAGG - Exonic
1083562374 11:63682770-63682792 GCCAGGCAGCTCTTACCAGCAGG - Intronic
1083977424 11:66134664-66134686 TACAGGGAGCCCTACCCAACTGG - Intronic
1084268990 11:68019252-68019274 GCCCGGCAGCCCTGCTCACCTGG - Exonic
1084460448 11:69294026-69294048 ACCAGGCAGCCCCACCCACCTGG + Intergenic
1084925522 11:72508287-72508309 TCCAGGGACTCCCTCCCACCTGG + Intergenic
1085282972 11:75342723-75342745 GCCACGGAGCCATTCTCTCCCGG - Intronic
1086679377 11:89651058-89651080 GCCAGGGAGCACTACAAACCTGG + Intergenic
1087127197 11:94639957-94639979 GCCAGGGAGCACTTCCTACCTGG - Intergenic
1087486669 11:98765295-98765317 TCCAGGGATCCCCTCCCACCTGG - Intergenic
1088010459 11:104994944-104994966 GCCAGGGAGCCCTTTTTACTTGG - Intronic
1088112839 11:106281925-106281947 GCCTGGGAGACCTTCCCACCTGG - Intergenic
1088983083 11:114881436-114881458 GCCAGGGAGAGCTTCCCGACTGG - Intergenic
1089190511 11:116650088-116650110 GCCAGGGAAGCCTTCCTACCAGG + Intergenic
1089658878 11:119972664-119972686 CCCAGGGAGCCCCTTCCACCAGG - Intergenic
1090487603 11:127127865-127127887 GCGAGGGAGCTCTTCTCACCTGG + Intergenic
1091115194 11:133006122-133006144 TCCAGGGATCTCCTCCCACCTGG - Intronic
1092564478 12:9649719-9649741 TCCAGGGACCCCTTCCCACCTGG + Intergenic
1092737072 12:11592721-11592743 TGCAGGGAGCCCTTCCCACCTGG + Intergenic
1093983091 12:25497184-25497206 TCCAGGGAACCCCTCCCACCTGG - Intronic
1096905656 12:54932926-54932948 GCCAGGGAGCCCTTCCCACCTGG + Intergenic
1097812319 12:64032326-64032348 TCCAGTGACCCCCTCCCACCTGG + Intronic
1098805452 12:75016140-75016162 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1100271530 12:93029860-93029882 TCTGGGGATCCCTTCCCACCTGG - Intergenic
1102246924 12:111361961-111361983 GCCAGAGAGCCACTGCCACCAGG + Exonic
1103989155 12:124786645-124786667 GCCAGGGACCTCCTCCCTCCAGG + Intronic
1104574888 12:129957864-129957886 TCTGGGGACCCCTTCCCACCTGG - Intergenic
1104775564 12:131388322-131388344 GCCAGGAAGCTCTGCCCTCCAGG - Intergenic
1104969283 12:132523917-132523939 GCTGGGCAGCCCTGCCCACCGGG - Intronic
1105578802 13:21675148-21675170 GCCAGAGCGCCCTTCCCCCTCGG - Intronic
1107256021 13:38427581-38427603 TCCAGGGACCCCCTCACACCTGG + Intergenic
1109388727 13:61666722-61666744 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1110413288 13:75226276-75226298 GCCAGGAAGCCCTTCCCACCTGG - Intergenic
1111132508 13:83996070-83996092 GCCGGGAACCCCCTCCCACCTGG - Intergenic
1111133067 13:84000616-84000638 GCCAGGGACTCCCTCCCACCTGG - Intergenic
1112192425 13:97191189-97191211 TCCGGGGACCCCCTCCCACCTGG - Intergenic
1112494358 13:99893741-99893763 GCCAAGGAGCCCTACAGACCTGG + Exonic
1112549907 13:100409602-100409624 TCCAGGGGCCCCTTCCCGCCTGG + Intronic
1112605795 13:100904539-100904561 GCCAGGGAGCCCTTTTTACCTGG + Intergenic
1113422352 13:110180483-110180505 GCCAGGGAGCAGGCCCCACCTGG + Intronic
1113682805 13:112255942-112255964 TCCAGGGGGCCCTTCCTTCCTGG - Intergenic
1113803964 13:113102781-113102803 ACCAGTGAGCACATCCCACCTGG - Intergenic
1114387185 14:22267519-22267541 TCTAGGGACCCCCTCCCACCTGG + Intergenic
1114526839 14:23371835-23371857 GCCAGTGTGTCCTTCCCCCCAGG - Intergenic
1116384879 14:44317625-44317647 ACCAGGGAGCCCTTCTCACCTGG + Intergenic
1116762624 14:49033270-49033292 GCCGGGGAGCCCTTCCTACCTGG - Intergenic
1117284964 14:54278248-54278270 GCCAGGGAACCCCTCCCACCCGG - Intergenic
1117406782 14:55411791-55411813 GCCCGGGCTCCCTTCCCACTGGG + Exonic
1119736481 14:76985903-76985925 CCCAGGGAGACTTTTCCACCAGG + Intergenic
1119739998 14:77008083-77008105 GGCAGGGAGACCTGCCCAACAGG + Intergenic
1119898181 14:78238426-78238448 GCCAGGGAGCCCTCTTCACCTGG - Intergenic
1120117843 14:80641378-80641400 GCCAGCGTGCCCTTTCCACTTGG + Intronic
1120320653 14:82956341-82956363 TCCGGGGACCCCTTCCCACCTGG + Intergenic
1120477084 14:85001994-85002016 GCCAGGGCCCCCCTCCCACCTGG + Intergenic
1120571925 14:86129530-86129552 GCCAGGGAACTCTTCCCCCCTGG - Intergenic
1121098528 14:91234083-91234105 GCCAGGGAGGCCTACCCGCTGGG - Exonic
1122784615 14:104157968-104157990 GCCATGGGGCCCTGCCCACAAGG - Intronic
1122836420 14:104433059-104433081 CCCCGGGTGCCCTTCCCACGGGG + Intergenic
1124154044 15:27209626-27209648 ACCAGGGAGGCCCACCCACCTGG - Intronic
1124594900 15:31084046-31084068 GCCAGGGTTCCCTTTCCTCCGGG + Intronic
1126767069 15:52019658-52019680 GCCAGCGCGCCCCTCCCACCCGG + Intronic
1129532249 15:76277787-76277809 GCCACCGTGCCCTGCCCACCTGG + Intronic
1130862354 15:87902317-87902339 GTCAGGGAGGCCTTGCCATCAGG - Intronic
1131517144 15:93087207-93087229 GCCAGGGTGCCCTTCAGAACCGG + Intronic
1132708648 16:1256996-1257018 GCCTCGGAGACCTTCCCCCCGGG + Exonic
1136288966 16:29260297-29260319 GCCAGAGAGCCGTCCCCGCCGGG + Intergenic
1136428951 16:30186130-30186152 GCCAGGGAGCCTGTCCCAACTGG - Intronic
1139432863 16:66920443-66920465 TCCAGGGAGCCCTGGCAACCTGG - Intergenic
1139488206 16:67271244-67271266 CCCAGGGAGCACTTCCCACAGGG - Exonic
1140499430 16:75421045-75421067 TCCAGGGACCCCCTCCCACATGG - Intronic
1141004606 16:80340270-80340292 TGCAGGGAGCCCTCTCCACCAGG - Intergenic
1141464356 16:84196367-84196389 CCCAGGGGGCCCTTCTCACTTGG - Exonic
1141574627 16:84955881-84955903 GCCAAGGAGCCATTACCTCCTGG - Intergenic
1141995528 16:87634529-87634551 TGCAGGGACCCCTTCCCACCTGG - Intronic
1142011039 16:87714323-87714345 GCTATGGAGCCTGTCCCACCCGG + Intronic
1142068688 16:88077370-88077392 GCCAGCGAGCCCAACCCCCCAGG - Intronic
1142094699 16:88233224-88233246 GCCAGAGAGCCGTCCCCGCCAGG + Intergenic
1142128194 16:88420520-88420542 GCCTGGGAGCCCTGCACACTCGG - Intergenic
1142142043 16:88476799-88476821 GCCAGGGAGGGCTTCCCAGAGGG + Intronic
1142221003 16:88854956-88854978 GACAGGAAGCCCCGCCCACCTGG - Intronic
1142570261 17:868995-869017 GCCTGGGAGACCTTCCACCCGGG - Intronic
1142570356 17:869632-869654 CTCAGGGAGCCCTCCCCACTCGG + Intronic
1143016481 17:3893380-3893402 GCCAGAGCGCCCCTCCCTCCCGG + Intronic
1144439154 17:15265811-15265833 AACAGGGAGTCCTTCCAACCAGG - Intergenic
1144451606 17:15384596-15384618 GCCAGGCAGCCATTCCCTCTGGG - Intergenic
1144587303 17:16494988-16495010 GACAGTGAGCTCTACCCACCTGG + Intergenic
1144761656 17:17710723-17710745 GCCAGGGCACCCCTCCCACAAGG + Intronic
1144778150 17:17795215-17795237 GCCAGGGTGCAATCCCCACCTGG - Exonic
1145997939 17:29115197-29115219 GCCAGCATGCCCTCCCCACCAGG - Intronic
1147862151 17:43530029-43530051 GCCAGGGAGACCCTCCCCCATGG + Intronic
1149094508 17:52824764-52824786 TCCAGGGAGCCCCTCCCACCTGG + Intergenic
1150004941 17:61463636-61463658 GGCAGTGAGCCCTTCGCTCCTGG + Intronic
1150477464 17:65486011-65486033 GTCAGGGAGCCCCACCCTCCAGG + Intergenic
1150610261 17:66727851-66727873 GCCCTGGCGCCCTGCCCACCTGG + Intronic
1151478233 17:74355527-74355549 GCCAGGGAGCCCAGCCGTCCTGG - Exonic
1151972491 17:77465988-77466010 CCCTGGGAGACCTGCCCACCTGG - Intronic
1151997543 17:77619467-77619489 TCTTGGGACCCCTTCCCACCTGG - Intergenic
1152248753 17:79200545-79200567 GCCAGGGACCCCACACCACCTGG + Intronic
1152263181 17:79278219-79278241 GCCAGGGAGCCCGTCAGGCCTGG - Intronic
1152419115 17:80182590-80182612 GCCAGGGAGCCCAGCCCCCTTGG + Intronic
1152660498 17:81539794-81539816 GCTTGGGAGCCCTCACCACCGGG - Intergenic
1152753618 17:82077832-82077854 GACAGGGAGCCCTGGGCACCTGG - Intergenic
1152889987 17:82874746-82874768 GCCCAGGAGCCCTGCGCACCCGG + Intronic
1153948202 18:10035303-10035325 GCCACTGAGCCCTTCCCAGCGGG + Intergenic
1153991313 18:10403288-10403310 GCCAGAGAGTCCTTCTCTCCAGG - Intergenic
1154400765 18:14034694-14034716 GCCAGGGACCCCTATCCCCCAGG + Intergenic
1155593470 18:27454523-27454545 TCCAGGGACCGCCTCCCACCTGG + Intergenic
1156112526 18:33745261-33745283 GCCAAGTAGCCCTTACCATCTGG - Exonic
1157276224 18:46312809-46312831 GGCAGGCAGCATTTCCCACCTGG - Intergenic
1157606774 18:48930676-48930698 GTGGGGGAGCCCTACCCACCGGG - Intronic
1158151790 18:54382390-54382412 TCTGGGGACCCCTTCCCACCTGG + Intronic
1158535803 18:58307130-58307152 CCCGGGGAGCCATTTCCACCTGG - Intronic
1158640861 18:59202535-59202557 GCCAGGGACCCCCTCCCACCTGG - Intergenic
1159655152 18:71024109-71024131 GCCAGGGAGCCATTTCCACCTGG + Intergenic
1159783888 18:72692116-72692138 GCCAGGGAGCCCTTCCCACCTGG - Intergenic
1160862956 19:1245338-1245360 GCCAGGGAGCCGCCCCCTCCTGG - Intergenic
1160952884 19:1675981-1676003 GCCAGGCTGCCGTTCCCAGCCGG - Intergenic
1161316389 19:3619483-3619505 TCCAGGAAGCCCCTCCCACCTGG - Intronic
1161595954 19:5151108-5151130 GCCAGGGTGCCCACCCCACTAGG + Intronic
1163552715 19:17974407-17974429 GCCAGGGAGCCCTCACCTCCGGG - Intronic
1163561140 19:18020377-18020399 GGCAGGGAGCCCAGCCCAGCCGG + Intergenic
1163704612 19:18804875-18804897 GCCTGGGAGCCCTACAGACCGGG - Intergenic
1163721348 19:18899604-18899626 GCCCTGCAGCCCTCCCCACCCGG - Exonic
1164131980 19:22371894-22371916 GCCAGTGAGCCCTTTCAACCAGG + Intergenic
1164167644 19:22696168-22696190 GCCAGTGAGCCCTTTCAACCAGG - Intergenic
1164217952 19:23167437-23167459 GTCAGTGAGCCCTTTCAACCAGG - Intergenic
1164552408 19:29222483-29222505 GCCCTGGAGCCCTGCCCACCCGG + Intergenic
1165407072 19:35637563-35637585 GCCAGGCACCCGCTCCCACCTGG + Exonic
1166366737 19:42281702-42281724 GCAGGGGGGCCCTTCCCGCCCGG + Intronic
1166393252 19:42421941-42421963 TGCAGGGAGCCCTGCCCAACTGG + Intronic
1167376364 19:49114452-49114474 GCCAGGGGGCCCTGCCCACCCGG + Intronic
1167419743 19:49395798-49395820 TCCAGGGAGCCCTGACCTCCCGG + Exonic
1168081916 19:54016326-54016348 GACAAAGAGCCATTCCCACCAGG - Intergenic
925160615 2:1681106-1681128 CCTGGGGACCCCTTCCCACCTGG - Intronic
925410761 2:3638629-3638651 GCCACAGAGCCCTTTCTACCAGG - Intronic
925684860 2:6459597-6459619 CCCTGTGAGCCCATCCCACCAGG - Intergenic
926125580 2:10269916-10269938 GTCAGAAAGCCTTTCCCACCTGG - Intergenic
926142362 2:10375341-10375363 ATGAGGGAGCCCCTCCCACCTGG + Intronic
927852768 2:26510537-26510559 CCCAGGGAGGCCTTTTCACCTGG - Intronic
928128436 2:28631776-28631798 GCTAGGGAGCTTCTCCCACCAGG + Intronic
928167005 2:28979098-28979120 GCCTGGCTGCCCTCCCCACCTGG + Intronic
928182972 2:29082703-29082725 TCCAGGGACCCCCACCCACCTGG + Intergenic
930545511 2:52762102-52762124 TCCAGGGACCCCTTCCTACCTGG + Intergenic
931938747 2:67228746-67228768 TCCAGCGAGTCCTTCCCACCTGG + Intergenic
932196248 2:69786533-69786555 GCAAGGCAGCCCTTCAAACCAGG - Intronic
932269756 2:70399190-70399212 GCTGGGGAGTCCTTGCCACCAGG - Intergenic
932494035 2:72137794-72137816 CCCATGGACCCCTTCCCCCCAGG - Intronic
932522231 2:72426970-72426992 GCCTGGGAGCCCATCCCGTCTGG - Intronic
935597337 2:104889484-104889506 GCCACGGAGCCCCTCCTACCTGG + Intergenic
935785502 2:106544985-106545007 GTCAAGGAGCACCTCCCACCTGG + Intergenic
936103959 2:109608546-109608568 GCTGGGGAGCCCATCCTACCTGG + Intronic
937153135 2:119699655-119699677 TCCAGGGACCCCCTCCCACCTGG + Intergenic
938705081 2:133916790-133916812 TCATGGGACCCCTTCCCACCTGG - Intergenic
938924748 2:136028846-136028868 GCCACTGAGCCCAACCCACCTGG + Intergenic
940190018 2:151030925-151030947 TCCGGGGACCCCTTCCCACCTGG + Intronic
941249324 2:163143530-163143552 TCTGGGGACCCCTTCCCACCAGG - Intergenic
941687015 2:168456993-168457015 GCCAGGCAGGGCTTCCCGCCGGG + Intronic
942838910 2:180336426-180336448 TCCAGGGACCCCCTCCCACCTGG - Intergenic
942839409 2:180341158-180341180 TCCAGGGACCCCTTCCCACCTGG - Intergenic
943905906 2:193501317-193501339 GCCAGGGAGCCCTTCCCACCTGG + Intergenic
945631883 2:212288425-212288447 GCCAGGGAGCCCTTTTTACTTGG - Intronic
946032682 2:216717666-216717688 GCCAGGAAGCCTTTCCTACAGGG + Intergenic
947853591 2:233307982-233308004 GCCACCCGGCCCTTCCCACCTGG + Exonic
948145829 2:235707557-235707579 GCTGGGGAGCACGTCCCACCAGG - Intronic
948671577 2:239571834-239571856 GCCCGGGTGACCTTCCCTCCAGG - Intergenic
949053613 2:241911716-241911738 GTCTGGGAGCCCTTTCCTCCAGG - Intergenic
1168750341 20:277457-277479 GCCAAGGAGACCTTGCCTCCTGG - Intronic
1169288319 20:4328100-4328122 GCCAAGGAGAACTGCCCACCAGG + Intergenic
1169699703 20:8432368-8432390 TCCAAGGACCTCTTCCCACCTGG + Intronic
1169872471 20:10262751-10262773 GCCAAGGAGCCCTTGCCAGCAGG + Intronic
1169967806 20:11236842-11236864 TCTGGGGACCCCTTCCCACCTGG + Intergenic
1170568584 20:17620492-17620514 GCCAGGGTGACCGTCCCAGCTGG - Intronic
1170628834 20:18050831-18050853 GCCAGGGAACACTTCCTACTGGG - Intronic
1170780543 20:19421895-19421917 GCCAGGGAACTCTTCGCACCTGG + Intronic
1170955392 20:20974773-20974795 GACAGGGAGCCCATCCAGCCTGG + Intergenic
1171065278 20:22009023-22009045 GCCCAGGATCCCTTCCCATCAGG - Intergenic
1171205034 20:23272470-23272492 CCCAGAGAGCCCTACCCACCAGG - Intergenic
1172611463 20:36255766-36255788 GCGAGGGGCCCCTTCCCACAGGG + Exonic
1172699344 20:36843327-36843349 GTTAGGGAGCCCTGCCCTCCAGG + Intronic
1172986612 20:38996615-38996637 GCCAGGGACCACATCTCACCTGG - Intronic
1173025312 20:39301943-39301965 CCCAGGGAGCCCTGGCCTCCTGG + Intergenic
1173838356 20:46140130-46140152 GCCAGCCTGCCCTGCCCACCTGG - Intergenic
1175916264 20:62427398-62427420 GCCAGGGATCCCAGCTCACCCGG + Intronic
1175951516 20:62586140-62586162 GCTAGGAAGCTCTTCACACCAGG + Intergenic
1176037064 20:63044732-63044754 GCCTGGGAGCCCTGTGCACCGGG - Intergenic
1176149584 20:63583071-63583093 GCCAGGGAGCCCCTCCTGCTGGG + Intergenic
1177305203 21:19306542-19306564 TGCAGGGAGCCCTTCCCACCTGG - Intergenic
1178404969 21:32316520-32316542 GGCAGGGAGCCCCTTCCACCCGG - Exonic
1178437813 21:32575273-32575295 GCAGGGAAGCCCTTCCCATCAGG - Intergenic
1178620132 21:34166955-34166977 TCCAGGGACCCCTTCCCACCTGG + Intergenic
1178682451 21:34684324-34684346 GCCAGCCTGCTCTTCCCACCCGG - Intronic
1178899538 21:36588092-36588114 ACCAAGGAGCCCGGCCCACCAGG - Intergenic
1179552129 21:42150261-42150283 GCCAGGGCCTCCCTCCCACCTGG + Intergenic
1179573556 21:42292349-42292371 GCCATGGAGCCCATCTCACAAGG + Intronic
1179984847 21:44914439-44914461 GGCCGGGCGCCCTTCCCTCCCGG + Intronic
1180056668 21:45362465-45362487 GCCAGTGAGCCCATTCCACAGGG + Intergenic
1180131027 21:45827181-45827203 GACAAGGAGCCCTTCCCATCTGG + Intronic
1181369217 22:22403513-22403535 GATAGGGAGCTCTTCCCTCCGGG - Intergenic
1181635575 22:24172872-24172894 GGCAGGGAGCCCTTCCCTGTTGG + Intronic
1181659225 22:24329645-24329667 CCCAGGGAGACTTCCCCACCCGG + Intronic
1182013099 22:27016848-27016870 CCTAGTGAGCCCTTCCAACCAGG - Intergenic
1182119549 22:27777978-27778000 ACCAGGGATTCCTACCCACCAGG + Intronic
1182524300 22:30906076-30906098 TCCGGGGCGCCCTTCCCGCCCGG - Intronic
1182926640 22:34131290-34131312 GCCAGAGAGCCCATCCTGCCTGG + Intergenic
1183521307 22:38297675-38297697 TCCTGGGACCCGTTCCCACCAGG + Intronic
1184172082 22:42765738-42765760 GTGAGGGAGCCCCTCCCTCCAGG - Intergenic
1184377598 22:44124529-44124551 CCCAGGGAGACCCTTCCACCAGG - Intronic
1184695354 22:46135801-46135823 TCCATGGAGCCCTTCCCCGCCGG - Intergenic
1184762076 22:46550471-46550493 GCCAGGCAGCCTTTCTCACTGGG + Intergenic
1184777607 22:46631324-46631346 GGCAGGGAGGAATTCCCACCAGG - Intronic
1184853657 22:47135073-47135095 GCCAGTGTCCCCTTCCCAGCTGG - Intronic
1185031178 22:48443755-48443777 GCCAGGGATACCCTCCCACTTGG - Intergenic
1185064260 22:48622875-48622897 GACAGGGCCACCTTCCCACCTGG + Intronic
1185091662 22:48778965-48778987 GCCAGGGACACCAGCCCACCAGG + Intronic
1185370804 22:50460061-50460083 GACAGCAAGCCCTTTCCACCAGG + Exonic
949307380 3:2658104-2658126 GCCAGGTACCCCCTCCGACCTGG - Intronic
950053862 3:10010709-10010731 GACTGGGAGCCCTTCACCCCAGG + Intronic
950833415 3:15897472-15897494 GGAATGGATCCCTTCCCACCTGG + Intergenic
951346074 3:21547944-21547966 TCCAGGGACCCCCTCCCACCTGG - Intronic
951677636 3:25260145-25260167 TCCAGGGAACACTGCCCACCGGG - Intronic
951907505 3:27719867-27719889 TCCCAGGAGCCCTTCCCACCTGG + Intronic
952415780 3:33090666-33090688 GTCATGGAGACCTGCCCACCAGG + Exonic
952485342 3:33804343-33804365 TCCAGGGACCCCCTCCCACCTGG + Intronic
954598317 3:51846307-51846329 ACCAGGGAGCCCTTCCCACCTGG + Intergenic
954968683 3:54633690-54633712 GCCAAGGAGTCCTTCCCACCTGG + Intronic
956731485 3:72200670-72200692 GCCAGGGAGCCCTCTCCATCAGG - Intergenic
957730263 3:84125476-84125498 GCCTGGGAGCTCTTGCAACCCGG + Intergenic
957952694 3:87145816-87145838 TCCAGGGACACCCTCCCACCTGG - Intergenic
959376726 3:105596733-105596755 GGGAGGGAGCCCTTCCCATTTGG + Intergenic
959623433 3:108423249-108423271 TCCAGGGACCCCCTCCCACCTGG + Intronic
959820528 3:110730007-110730029 GCCAGGGAGCCCTTCCCACCTGG - Intergenic
960504662 3:118478445-118478467 GCCAGGGATCCGTTCCCATCTGG - Intergenic
961987978 3:131157976-131157998 GCCAGGGAGACCATCCCCCTAGG + Intronic
962742145 3:138369679-138369701 GCCGGGGTTCCCTTCCCACTTGG - Intronic
963327272 3:143876504-143876526 GGCAGGGAGCCGTCCCCATCTGG - Intergenic
964722587 3:159782027-159782049 ACTTGGGAGCCCTTGCCACCAGG + Intronic
964980376 3:162670320-162670342 CCCAGGGACCCTCTCCCACCTGG - Intergenic
965894108 3:173552761-173552783 GCCAGGGAGCCCTTCCCACCTGG + Intronic
966423523 3:179757195-179757217 GACACAGAGCCGTTCCCACCTGG - Intronic
966600845 3:181773706-181773728 GTCAGGCAGCCCTTCCCACATGG + Intergenic
967630321 3:191737682-191737704 TCCAGGGACCCCCTCCAACCTGG + Intergenic
967657108 3:192063709-192063731 GCCAGGAAGCCCTTCCCACCCGG - Intergenic
969585144 4:8087296-8087318 GCCAGGTGGCCTTTCCCAGCTGG - Intronic
971711409 4:30118319-30118341 GCCAGGGACCCCCTCCCACCTGG - Intergenic
971792180 4:31183876-31183898 TCCAGGGACCACCTCCCACCTGG + Intergenic
971849745 4:31968987-31969009 GCCAGGGTCCCCGTCCCACAGGG + Intergenic
973095662 4:46196227-46196249 TCCAGGAAACCCCTCCCACCTGG - Intergenic
974165406 4:58195484-58195506 TCTGGGGAACCCTTCCCACCTGG - Intergenic
974674753 4:65075976-65075998 TCCAGGGAACACCTCCCACCAGG - Intergenic
975223198 4:71838170-71838192 GCCAGGGAGACTTTTCCATCTGG + Intergenic
975614678 4:76234627-76234649 TCCGGGGACCCCCTCCCACCTGG + Intronic
975634717 4:76436145-76436167 CCCAGGGAGCTCCTCCCTCCAGG - Exonic
976826203 4:89263354-89263376 TCCGGGGACCCCCTCCCACCTGG - Intronic
977127466 4:93187941-93187963 TCCAGGAAGCCCTGCCCACATGG + Intronic
977352916 4:95910982-95911004 GCCAGGGAGTCCCTCCCACCTGG + Intergenic
978918377 4:114151911-114151933 TCCACGGAGCCCCTCCAACCTGG + Intergenic
979575994 4:122293422-122293444 GCCAGGGAGCCCCCACCCCCAGG + Intronic
980726602 4:136769828-136769850 TCCAGGGACCCCCTTCCACCTGG - Intergenic
981255421 4:142656033-142656055 TCCAGGGACCCCCTCCCACCTGG - Intronic
981606657 4:146547165-146547187 GCCAGCGTGCCCCTCCCACTGGG + Intergenic
981652558 4:147076366-147076388 GCCAGGGAGCCCCTCCCACCTGG - Intergenic
983321710 4:166203145-166203167 TCCAGGGACCCCCTCCCATCTGG - Intergenic
984244952 4:177263944-177263966 GCCAGGGAGCCGTTCCCACCTGG - Intergenic
985570779 5:643666-643688 CCCAGGGATCCCGTCTCACCTGG - Intronic
985626254 5:990075-990097 GCCAGGCAGCCCATCCCAGGGGG - Intergenic
985906539 5:2842008-2842030 GACAGGGAGCCCCTACCGCCTGG - Intergenic
986177857 5:5366995-5367017 GCCAGGGAGCCCTTCCCACCAGG + Intergenic
986213842 5:5699375-5699397 TCCAGGGATCCTTTCCCGCCTGG - Intergenic
986691360 5:10316409-10316431 GCCAGGGAGCCCTTCCCACCTGG + Intergenic
987526794 5:19061264-19061286 GCCAGGAATCCCTTCCCACCTGG + Intergenic
987568582 5:19625725-19625747 GCCAGGGACCCCCTCCCATCTGG - Intronic
987889913 5:23863901-23863923 GTCAGGGGGCCCTTCTCACCTGG - Intergenic
988054846 5:26081210-26081232 TCCAGGGGACCCTTTCCACCTGG + Intergenic
988899549 5:35717789-35717811 TCCAGGGACCCCCTGCCACCTGG + Intronic
988900199 5:35723163-35723185 TCCAGGGACCCCCTCCCACCTGG + Intronic
989230485 5:39080778-39080800 GCCAGGGGGCACTACCAACCTGG - Intergenic
990019895 5:51112822-51112844 ACCAGGGAACACTTCCCAGCTGG + Intergenic
991968544 5:72115514-72115536 GCCAGGGAGGTCTCTCCACCAGG - Intronic
992312003 5:75511079-75511101 GCCAGGGGTCCCTTGGCACCAGG + Intronic
992427084 5:76669390-76669412 GCCAGGCACCTCTGCCCACCAGG + Intronic
992662921 5:78979477-78979499 GCCAGGGACCCCCTCCCACCTGG - Intronic
993187266 5:84635963-84635985 GCCTGGGAGCAAGTCCCACCTGG + Intergenic
994505869 5:100642148-100642170 TCCAGGGACCCCCTCTCACCTGG - Intergenic
995393412 5:111663341-111663363 TCCAGGGACTCCCTCCCACCTGG + Intronic
995393899 5:111667075-111667097 TCCAGGGACCCCCTCCCACCTGG + Intronic
995635465 5:114185383-114185405 TCCAGGGAACCCCTCCCATCTGG - Intergenic
995829895 5:116344132-116344154 TCCAGGGACGCCCTCCCACCTGG + Intronic
995830455 5:116348841-116348863 TCCAGGGACCCCCTCCCACCTGG + Intronic
996287792 5:121815344-121815366 GCCAGGGAGACACTCCCACTTGG - Intergenic
996553821 5:124757679-124757701 TCCAGGGACCCCCTCCCACCTGG - Intergenic
996575490 5:124973007-124973029 TCCAGGGACCCCCTCCCACCTGG - Intergenic
996660992 5:126002562-126002584 GCCTGGGATCTCTTCCAACCAGG - Intergenic
996661502 5:126009056-126009078 TCCAGGGACCCCCTCCCACCTGG - Intergenic
996787556 5:127256629-127256651 GCAAGGGAGCCCTTAGCAACAGG - Intergenic
996834106 5:127772057-127772079 GCCAGGCACCCCTTCCTACCTGG + Intergenic
998142700 5:139709243-139709265 GCCGGGAGGACCTTCCCACCAGG - Intergenic
998204750 5:140150396-140150418 GGCAGGCAGCCCTGCCTACCAGG - Intergenic
998762602 5:145449233-145449255 GCTGGGAAGCCCTTCCCACCTGG - Intergenic
999008308 5:148006336-148006358 TCCAGGGACCTCCTCCCACCTGG - Intergenic
999460366 5:151752395-151752417 GCCGGGGATCCCTTCCTGCCTGG - Intronic
999553600 5:152717488-152717510 TCCAGGGAACCCCTCCCACCTGG - Intergenic
999717867 5:154376463-154376485 GTAAGGGAGCCCCTCCCACTTGG + Intronic
999897615 5:156052239-156052261 TCCAGGGATCCCCTCCCACCTGG + Intronic
1000009824 5:157220519-157220541 CCCGTGGAGCTCTTCCCACCTGG + Intronic
1000022798 5:157333195-157333217 TCCAGGAAACCCCTCCCACCTGG + Intronic
1001159524 5:169300958-169300980 GCCAGGGGGCGCTCCGCACCTGG - Intronic
1001906703 5:175478907-175478929 GGCGGAGGGCCCTTCCCACCGGG - Intronic
1002474500 5:179456328-179456350 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1002649182 5:180679321-180679343 GCCAGGGAGCTCTGACCACATGG + Intergenic
1002858755 6:1061078-1061100 GCCAGGAAGACCGTCCCGCCAGG - Intergenic
1002928758 6:1619722-1619744 GCCAGAGGGCCCTTCCCAGTCGG + Intergenic
1003196547 6:3920023-3920045 TCCCGGGACCCCCTCCCACCTGG + Intergenic
1004485233 6:16060231-16060253 TCCAAGGACCCCCTCCCACCTGG - Intergenic
1005025350 6:21457910-21457932 TCCAGGGATCTCCTCCCACCTGG + Intergenic
1005358134 6:25004587-25004609 GCCAGGGATCCCTGCTCAGCAGG + Intronic
1005578039 6:27208318-27208340 TCCAGGGACCCCCTCCCACCTGG + Intergenic
1005787868 6:29264694-29264716 TCCAGGGAACACCTCCCACCTGG - Intergenic
1006017170 6:31091149-31091171 TCCAGGGAACCCCTCCCACCTGG - Intergenic
1006102298 6:31693118-31693140 TCGAGGGGGCCCTTCCCGCCGGG - Exonic
1006245890 6:32735522-32735544 TCTGGGGACCCCTTCCCACCTGG - Intergenic
1006373555 6:33659583-33659605 GCCACCTAGCCCTCCCCACCAGG + Intronic
1006784961 6:36660316-36660338 GTGAGGGAGCCCGCCCCACCAGG - Intergenic
1007228590 6:40332009-40332031 GCCAGGCAGCTCATCACACCAGG - Intergenic
1008149556 6:47934106-47934128 GCCTGGGACCCCCTCCCACCTGG - Intronic
1009840964 6:69073690-69073712 GTCAGGGAGCCCTTCCCACCTGG + Intronic
1009907795 6:69890832-69890854 TCCAAGGACCCCCTCCCACCTGG + Intronic
1009908383 6:69895692-69895714 TCCAGGGACCCCCTCCCACTTGG + Intronic
1011215333 6:84999667-84999689 TTCTGGGCGCCCTTCCCACCTGG - Intergenic
1011590435 6:88965829-88965851 GCCAAGGAATCCTTCCCACCTGG - Intergenic
1012526361 6:100182601-100182623 GCCAGGGAGGCCTTCACACTTGG - Intergenic
1013208361 6:107965033-107965055 GCCAGGTACCCCCTCCCACCTGG - Intergenic
1013410073 6:109876208-109876230 TCCAGGGACCCCCTCCCACCGGG - Intergenic
1015266300 6:131295167-131295189 GCCAGGGAGCCCTTCCCACCTGG - Intergenic
1015634702 6:135263874-135263896 GCCAGACAGTCCTTCCCACCTGG - Intergenic
1015803190 6:137081027-137081049 TCCAGGGAACCCCTCCCACCTGG + Intergenic
1017021402 6:150143085-150143107 GCCGGGGAGCCCTTCGCATGCGG + Exonic
1018239613 6:161760448-161760470 TCCAGGGACCCCCTCCCACCTGG - Intronic
1018737281 6:166696776-166696798 GAGAGGGACCCCTTCCCGCCTGG + Intronic
1020676642 7:11191962-11191984 TCCAGGGACCCCCTCCCACCTGG - Intergenic
1020677322 7:11197505-11197527 TCCAGGGACCCCCTCCCACCTGG - Intergenic
1021054945 7:16035914-16035936 TCCAGGAACCCCCTCCCACCTGG - Intergenic
1021193127 7:17644722-17644744 GCCAGGGAGACCTTACAACATGG - Intergenic
1021330953 7:19339203-19339225 CCCAGGGACCCCCTCCCACCTGG - Intergenic
1022032639 7:26506333-26506355 TCCAGGGAGCCCTCACCAGCAGG - Intergenic
1023367424 7:39477448-39477470 GCCAGGGAGCCCTTTCCACCTGG + Intronic
1023869270 7:44254215-44254237 CTCAGGCAGCCCTTCCCACAAGG - Intronic
1025770902 7:64505647-64505669 GCCAGTGAGCCCTTTCATCCAGG + Intergenic
1027660416 7:80981651-80981673 TCCAGGGACTCCCTCCCACCTGG + Intergenic
1028524457 7:91768085-91768107 TCCAGGGACCCCCTCCCACCTGG + Intronic
1028756509 7:94440991-94441013 TCCAGGGACCCTCTCCCACCTGG + Intergenic
1029463670 7:100711590-100711612 GGCAGGCAGCCTTTCCCATCTGG + Intergenic
1030082951 7:105793147-105793169 TCCAGGAAGCCCTTCCAAACTGG - Intronic
1030245913 7:107384328-107384350 TCCAGGGACCCCCTCCCACCTGG - Intronic
1031835177 7:126673017-126673039 TCCAGGCACCCCCTCCCACCTGG - Intronic
1033083560 7:138321105-138321127 GCCAGGTAGCCCTTCCCACCTGG + Intergenic
1033121972 7:138674514-138674536 GGCAGAGAGCCCTTCCTAGCTGG + Intronic
1033589079 7:142795804-142795826 CCCAGAGAACTCTTCCCACCTGG - Intergenic
1036645575 8:10609830-10609852 TCCTGGGAGCCTTTCCCATCCGG + Exonic
1037623711 8:20589642-20589664 TCTGGGGACCCCTTCCCACCTGG - Intergenic
1038864925 8:31429570-31429592 GCCAGGGAGTCCTTCCCACCTGG - Intergenic
1039391647 8:37185690-37185712 GCCAGGCAGCCCTTTTCACTTGG - Intergenic
1040064528 8:43134419-43134441 TCTGGGGACCCCTTCCCACCTGG - Intergenic
1040065119 8:43139298-43139320 ACCAGGGAACCCTTCCCATCTGG - Intergenic
1040542316 8:48371398-48371420 ACCAGTAAGCCCTACCCACCAGG - Intergenic
1040757970 8:50804229-50804251 GCTAGGGAGCTATTTCCACCTGG - Intergenic
1041200965 8:55451799-55451821 GGCAGCAAGCCCTTTCCACCAGG + Intronic
1041540739 8:58982192-58982214 GACAGCCAGCCCTTCCCACTTGG + Intronic
1046258990 8:111741283-111741305 GCCAGGGACCCCCTCCCAGCTGG - Intergenic
1046413847 8:113884439-113884461 GACAGGGTGCCCTTCCCTCTTGG + Intergenic
1048241014 8:132741570-132741592 GACAGGGGGCCCTTCCTGCCTGG + Intronic
1048682066 8:136853924-136853946 GCCAGGGAGCCCTTCCCACCTGG + Intergenic
1051014691 9:12460573-12460595 TCTGGGGACCCCTTCCCACCTGG + Intergenic
1051209053 9:14722350-14722372 GATAGTGAGCCCTTCCCACCTGG - Exonic
1051503985 9:17808050-17808072 GCCATGGGGCCATTCCTACCAGG + Intergenic
1052746944 9:32450170-32450192 GCCAGGGAGGCCTCTCCACCAGG - Exonic
1052980466 9:34444681-34444703 GCTAGGGACCCCTGCCCACTGGG + Intronic
1053285627 9:36848036-36848058 GCATGGGAGCCCTTCCCTACTGG + Intronic
1053388088 9:37711119-37711141 CCCAGAGAGCTCCTCCCACCTGG - Intronic
1054771264 9:69086421-69086443 TCCAGGGACCCCCTCCCACCTGG - Intronic
1056191625 9:84190011-84190033 GCCAGGGAGCTCTTCCCACCTGG - Intergenic
1056799235 9:89680002-89680024 CCCGGGGAAACCTTCCCACCTGG - Intergenic
1057140271 9:92722557-92722579 GACAGGAACCCCTTCCCAACAGG + Intronic
1057445888 9:95114283-95114305 GCCAGGGAGGGGTTCCCAGCAGG + Intronic
1057605768 9:96496868-96496890 GCGAGTGAGCCGTTCCCAGCTGG + Intronic
1059450702 9:114370087-114370109 GCCAGGGAGCCCCTTCCACCAGG - Intronic
1059465383 9:114466137-114466159 GCCAGGGAGGGCTCCCCAGCTGG + Intronic
1060232717 9:121837701-121837723 GCCAGACTGCCCTTCCCTCCTGG + Intronic
1060931310 9:127491292-127491314 GGCAGGGAGCCCTACATACCTGG - Exonic
1062039838 9:134399238-134399260 GCCAGGCAACCATGCCCACCAGG - Intronic
1062111175 9:134782848-134782870 GCCACTGTCCCCTTCCCACCAGG - Intronic
1186068081 X:5787975-5787997 GCCAGAGAGCCCTTCCCACCTGG + Intergenic
1186825962 X:13340311-13340333 GCCAGGGAGCCCTTCCCACCTGG + Intergenic
1186939501 X:14489677-14489699 GCCAAGGAGCCCTTACCACCTGG + Intergenic
1187062514 X:15800988-15801010 ACCAGGAAGCCCTTTCTACCTGG - Intronic
1188762815 X:34053681-34053703 GCCAGGGAGCACTTCCCACCTGG - Intergenic
1189152871 X:38725944-38725966 TCCAGGGACCCCCTTCCACCTGG - Intergenic
1189153479 X:38730780-38730802 TCTAGGGACCCCCTCCCACCTGG - Intergenic
1189284967 X:39845583-39845605 GCCAGGGAGCCTCCCCCACCTGG - Intergenic
1190491206 X:50983989-50984011 TCCAGGGACCCCCTCCCACTTGG - Intergenic
1192174178 X:68875528-68875550 GCCAGGGCTCCCATCCCACTTGG - Intergenic
1193075910 X:77355363-77355385 GCCAGGAAGCCTTTTCCATCTGG + Intergenic
1193481219 X:82031896-82031918 TCTGGGGACCCCTTCCCACCTGG - Intergenic
1194402627 X:93457842-93457864 TCCAGGGACCCCCTCCTACCTGG + Intergenic
1195334114 X:103832359-103832381 GCCAGGGAGCGCTTGCCACATGG - Intergenic
1197061735 X:122189969-122189991 GCCAGGGATCCCCTCCCACCTGG - Intergenic
1197062402 X:122196468-122196490 GCCAGGGACCCACTCCCACCTGG - Intergenic
1197348675 X:125356692-125356714 GCCAGGGAGCCATTCCCACATGG - Intergenic
1197388259 X:125827156-125827178 TCCAGGGACCCCTTCCCAGCTGG - Intergenic
1197662912 X:129193478-129193500 GCCAGGGAGCCCTTCCCACCTGG - Intergenic
1197701551 X:129603996-129604018 GCCAGGGAGCCCTTCCCATCTGG - Intergenic
1197837005 X:130705709-130705731 GCCAGGGAGCCCTTCCCACCTGG - Intronic
1198725920 X:139676869-139676891 GAGAGGGACACCTTCCCACCAGG + Intronic
1198936482 X:141905711-141905733 GACAGGGAGTCCTTCCCCTCAGG - Exonic
1199255705 X:145716344-145716366 TTCAGGGATCCCCTCCCACCTGG - Intergenic
1199500144 X:148499685-148499707 GCCAGGGAACCTTTCCCTCCAGG + Intergenic
1201526293 Y:14938283-14938305 GCCAGGGAACACTTCCCACCTGG - Intergenic