ID: 922864989

View in Genome Browser
Species Human (GRCh38)
Location 1:228852244-228852266
Sequence GGCCAGTCAGAGGGCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864989_922864993 -9 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922864993 1:228852258-228852280 TGACTGGCCTGTGCACTGGTAGG No data
922864989_922865001 17 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922865001 1:228852284-228852306 GCACGCTGGGGTGGAGCATGGGG No data
922864989_922864995 3 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922864995 1:228852270-228852292 GCACTGGTAGGAGTGCACGCTGG No data
922864989_922864998 8 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922864998 1:228852275-228852297 GGTAGGAGTGCACGCTGGGGTGG No data
922864989_922864999 15 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922864999 1:228852282-228852304 GTGCACGCTGGGGTGGAGCATGG No data
922864989_922865000 16 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922865000 1:228852283-228852305 TGCACGCTGGGGTGGAGCATGGG No data
922864989_922864997 5 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922864997 1:228852272-228852294 ACTGGTAGGAGTGCACGCTGGGG No data
922864989_922864996 4 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922864996 1:228852271-228852293 CACTGGTAGGAGTGCACGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922864989 Original CRISPR GGCCAGTCAGAGGGCCTGCC AGG (reversed) Intergenic
No off target data available for this crispr