ID: 922864990

View in Genome Browser
Species Human (GRCh38)
Location 1:228852253-228852275
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864990_922865001 8 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922865001 1:228852284-228852306 GCACGCTGGGGTGGAGCATGGGG No data
922864990_922864998 -1 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922864998 1:228852275-228852297 GGTAGGAGTGCACGCTGGGGTGG No data
922864990_922864999 6 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922864999 1:228852282-228852304 GTGCACGCTGGGGTGGAGCATGG No data
922864990_922865002 26 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922865002 1:228852302-228852324 TGGGGAAGTTCACGTCTTTGAGG No data
922864990_922865003 27 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922865003 1:228852303-228852325 GGGGAAGTTCACGTCTTTGAGGG No data
922864990_922865000 7 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922865000 1:228852283-228852305 TGCACGCTGGGGTGGAGCATGGG No data
922864990_922865005 29 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG No data
922864990_922864996 -5 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922864996 1:228852271-228852293 CACTGGTAGGAGTGCACGCTGGG No data
922864990_922864997 -4 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922864997 1:228852272-228852294 ACTGGTAGGAGTGCACGCTGGGG No data
922864990_922864995 -6 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922864995 1:228852270-228852292 GCACTGGTAGGAGTGCACGCTGG No data
922864990_922865004 28 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922865004 1:228852304-228852326 GGGAAGTTCACGTCTTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922864990 Original CRISPR CAGTGCACAGGCCAGTCAGA GGG (reversed) Intergenic