ID: 922864991

View in Genome Browser
Species Human (GRCh38)
Location 1:228852254-228852276
Sequence CCAGTGCACAGGCCAGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864991_922864998 -2 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922864998 1:228852275-228852297 GGTAGGAGTGCACGCTGGGGTGG No data
922864991_922864999 5 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922864999 1:228852282-228852304 GTGCACGCTGGGGTGGAGCATGG No data
922864991_922865002 25 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922865002 1:228852302-228852324 TGGGGAAGTTCACGTCTTTGAGG No data
922864991_922865003 26 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922865003 1:228852303-228852325 GGGGAAGTTCACGTCTTTGAGGG No data
922864991_922864997 -5 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922864997 1:228852272-228852294 ACTGGTAGGAGTGCACGCTGGGG No data
922864991_922864996 -6 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922864996 1:228852271-228852293 CACTGGTAGGAGTGCACGCTGGG No data
922864991_922865004 27 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922865004 1:228852304-228852326 GGGAAGTTCACGTCTTTGAGGGG No data
922864991_922865000 6 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922865000 1:228852283-228852305 TGCACGCTGGGGTGGAGCATGGG No data
922864991_922865001 7 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922865001 1:228852284-228852306 GCACGCTGGGGTGGAGCATGGGG No data
922864991_922864995 -7 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922864995 1:228852270-228852292 GCACTGGTAGGAGTGCACGCTGG No data
922864991_922865005 28 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922864991 Original CRISPR CCAGTGCACAGGCCAGTCAG AGG (reversed) Intergenic