ID: 922864993

View in Genome Browser
Species Human (GRCh38)
Location 1:228852258-228852280
Sequence TGACTGGCCTGTGCACTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864985_922864993 8 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC No data
Right 922864993 1:228852258-228852280 TGACTGGCCTGTGCACTGGTAGG No data
922864989_922864993 -9 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922864993 1:228852258-228852280 TGACTGGCCTGTGCACTGGTAGG No data
922864988_922864993 -8 Left 922864988 1:228852243-228852265 CCCTGGCAGGCCCTCTGACTGGC No data
Right 922864993 1:228852258-228852280 TGACTGGCCTGTGCACTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922864993 Original CRISPR TGACTGGCCTGTGCACTGGT AGG Intergenic