ID: 922864994

View in Genome Browser
Species Human (GRCh38)
Location 1:228852265-228852287
Sequence GTGCACTCCTACCAGTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864994_922865004 16 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865004 1:228852304-228852326 GGGAAGTTCACGTCTTTGAGGGG No data
922864994_922865002 14 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865002 1:228852302-228852324 TGGGGAAGTTCACGTCTTTGAGG No data
922864994_922865005 17 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG No data
922864994_922865000 -5 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865000 1:228852283-228852305 TGCACGCTGGGGTGGAGCATGGG No data
922864994_922865006 20 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865006 1:228852308-228852330 AGTTCACGTCTTTGAGGGGGAGG No data
922864994_922865007 27 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865007 1:228852315-228852337 GTCTTTGAGGGGGAGGAGCCTGG No data
922864994_922865003 15 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865003 1:228852303-228852325 GGGGAAGTTCACGTCTTTGAGGG No data
922864994_922865001 -4 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865001 1:228852284-228852306 GCACGCTGGGGTGGAGCATGGGG No data
922864994_922864999 -6 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922864999 1:228852282-228852304 GTGCACGCTGGGGTGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922864994 Original CRISPR GTGCACTCCTACCAGTGCAC AGG (reversed) Intergenic
No off target data available for this crispr