ID: 922864995

View in Genome Browser
Species Human (GRCh38)
Location 1:228852270-228852292
Sequence GCACTGGTAGGAGTGCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864990_922864995 -6 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922864995 1:228852270-228852292 GCACTGGTAGGAGTGCACGCTGG No data
922864989_922864995 3 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922864995 1:228852270-228852292 GCACTGGTAGGAGTGCACGCTGG No data
922864988_922864995 4 Left 922864988 1:228852243-228852265 CCCTGGCAGGCCCTCTGACTGGC No data
Right 922864995 1:228852270-228852292 GCACTGGTAGGAGTGCACGCTGG No data
922864985_922864995 20 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC 0: 14
1: 16
2: 28
3: 92
4: 338
Right 922864995 1:228852270-228852292 GCACTGGTAGGAGTGCACGCTGG No data
922864991_922864995 -7 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922864995 1:228852270-228852292 GCACTGGTAGGAGTGCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922864995 Original CRISPR GCACTGGTAGGAGTGCACGC TGG Intergenic
No off target data available for this crispr