ID: 922864997

View in Genome Browser
Species Human (GRCh38)
Location 1:228852272-228852294
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864988_922864997 6 Left 922864988 1:228852243-228852265 CCCTGGCAGGCCCTCTGACTGGC No data
Right 922864997 1:228852272-228852294 ACTGGTAGGAGTGCACGCTGGGG No data
922864985_922864997 22 Left 922864985 1:228852227-228852249 CCAGGTGGGAAGGGCTCCCTGGC No data
Right 922864997 1:228852272-228852294 ACTGGTAGGAGTGCACGCTGGGG No data
922864990_922864997 -4 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922864997 1:228852272-228852294 ACTGGTAGGAGTGCACGCTGGGG No data
922864989_922864997 5 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922864997 1:228852272-228852294 ACTGGTAGGAGTGCACGCTGGGG No data
922864991_922864997 -5 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922864997 1:228852272-228852294 ACTGGTAGGAGTGCACGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type