ID: 922865000

View in Genome Browser
Species Human (GRCh38)
Location 1:228852283-228852305
Sequence TGCACGCTGGGGTGGAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864991_922865000 6 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922865000 1:228852283-228852305 TGCACGCTGGGGTGGAGCATGGG No data
922864990_922865000 7 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922865000 1:228852283-228852305 TGCACGCTGGGGTGGAGCATGGG No data
922864988_922865000 17 Left 922864988 1:228852243-228852265 CCCTGGCAGGCCCTCTGACTGGC No data
Right 922865000 1:228852283-228852305 TGCACGCTGGGGTGGAGCATGGG No data
922864989_922865000 16 Left 922864989 1:228852244-228852266 CCTGGCAGGCCCTCTGACTGGCC No data
Right 922865000 1:228852283-228852305 TGCACGCTGGGGTGGAGCATGGG No data
922864994_922865000 -5 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865000 1:228852283-228852305 TGCACGCTGGGGTGGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922865000 Original CRISPR TGCACGCTGGGGTGGAGCAT GGG Intergenic
No off target data available for this crispr