ID: 922865003

View in Genome Browser
Species Human (GRCh38)
Location 1:228852303-228852325
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864994_922865003 15 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865003 1:228852303-228852325 GGGGAAGTTCACGTCTTTGAGGG No data
922864990_922865003 27 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922865003 1:228852303-228852325 GGGGAAGTTCACGTCTTTGAGGG No data
922864991_922865003 26 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922865003 1:228852303-228852325 GGGGAAGTTCACGTCTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type