ID: 922865005

View in Genome Browser
Species Human (GRCh38)
Location 1:228852305-228852327
Sequence GGAAGTTCACGTCTTTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922864990_922865005 29 Left 922864990 1:228852253-228852275 CCCTCTGACTGGCCTGTGCACTG No data
Right 922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG No data
922864994_922865005 17 Left 922864994 1:228852265-228852287 CCTGTGCACTGGTAGGAGTGCAC No data
Right 922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG No data
922864991_922865005 28 Left 922864991 1:228852254-228852276 CCTCTGACTGGCCTGTGCACTGG No data
Right 922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922865005 Original CRISPR GGAAGTTCACGTCTTTGAGG GGG Intergenic
No off target data available for this crispr