ID: 922867873

View in Genome Browser
Species Human (GRCh38)
Location 1:228875940-228875962
Sequence AATAATAAGGAGGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922867873_922867881 17 Left 922867873 1:228875940-228875962 CCTCCCTCCTCCTCCTTATTATT No data
Right 922867881 1:228875980-228876002 ATGTTGCCTGTTTTGCAAAAGGG No data
922867873_922867880 16 Left 922867873 1:228875940-228875962 CCTCCCTCCTCCTCCTTATTATT No data
Right 922867880 1:228875979-228876001 AATGTTGCCTGTTTTGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922867873 Original CRISPR AATAATAAGGAGGAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr