ID: 922868772

View in Genome Browser
Species Human (GRCh38)
Location 1:228883384-228883406
Sequence GGCAAGTGCCATCGTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922868772_922868778 22 Left 922868772 1:228883384-228883406 CCTGCCCCACGATGGCACTTGCC No data
Right 922868778 1:228883429-228883451 TCGAAATGCTAACCAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922868772 Original CRISPR GGCAAGTGCCATCGTGGGGC AGG (reversed) Intergenic
No off target data available for this crispr