ID: 922869069

View in Genome Browser
Species Human (GRCh38)
Location 1:228885423-228885445
Sequence CCTCAAGCATAGTCTTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922869065_922869069 0 Left 922869065 1:228885400-228885422 CCAGTCTGGTCTCGAACTCCTGG 0: 179
1: 12037
2: 112951
3: 217985
4: 209835
Right 922869069 1:228885423-228885445 CCTCAAGCATAGTCTTTGAATGG No data
922869064_922869069 1 Left 922869064 1:228885399-228885421 CCCAGTCTGGTCTCGAACTCCTG 0: 175
1: 10575
2: 56561
3: 67699
4: 47589
Right 922869069 1:228885423-228885445 CCTCAAGCATAGTCTTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922869069 Original CRISPR CCTCAAGCATAGTCTTTGAA TGG Intergenic
No off target data available for this crispr