ID: 922871043

View in Genome Browser
Species Human (GRCh38)
Location 1:228902200-228902222
Sequence AGACACTGGCCACAATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922871043_922871047 -4 Left 922871043 1:228902200-228902222 CCCTGGGATTGTGGCCAGTGTCT No data
Right 922871047 1:228902219-228902241 GTCTTGGAGAAAGAGACTACAGG No data
922871043_922871048 9 Left 922871043 1:228902200-228902222 CCCTGGGATTGTGGCCAGTGTCT No data
Right 922871048 1:228902232-228902254 AGACTACAGGTAGCGTAAAGTGG No data
922871043_922871050 21 Left 922871043 1:228902200-228902222 CCCTGGGATTGTGGCCAGTGTCT No data
Right 922871050 1:228902244-228902266 GCGTAAAGTGGGTTGTTTTCAGG No data
922871043_922871051 25 Left 922871043 1:228902200-228902222 CCCTGGGATTGTGGCCAGTGTCT No data
Right 922871051 1:228902248-228902270 AAAGTGGGTTGTTTTCAGGAAGG No data
922871043_922871049 10 Left 922871043 1:228902200-228902222 CCCTGGGATTGTGGCCAGTGTCT No data
Right 922871049 1:228902233-228902255 GACTACAGGTAGCGTAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922871043 Original CRISPR AGACACTGGCCACAATCCCA GGG (reversed) Intergenic
No off target data available for this crispr