ID: 922874459

View in Genome Browser
Species Human (GRCh38)
Location 1:228929057-228929079
Sequence AGAGCCCCAGCCTCTAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922874457_922874459 22 Left 922874457 1:228929012-228929034 CCAAAACATTGGTAATTTTCTGC No data
Right 922874459 1:228929057-228929079 AGAGCCCCAGCCTCTAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922874459 Original CRISPR AGAGCCCCAGCCTCTAGCAG TGG Intergenic
No off target data available for this crispr