ID: 922875827

View in Genome Browser
Species Human (GRCh38)
Location 1:228939223-228939245
Sequence TGTGAGGCGAAGGAATAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922875827_922875834 22 Left 922875827 1:228939223-228939245 CCTAGTTATTCCTTCGCCTCACA No data
Right 922875834 1:228939268-228939290 AAAGAAACACCTTTAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922875827 Original CRISPR TGTGAGGCGAAGGAATAACT AGG (reversed) Intergenic
No off target data available for this crispr