ID: 922881779

View in Genome Browser
Species Human (GRCh38)
Location 1:228986448-228986470
Sequence CTGGAGACCTGCAAATCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922881773_922881779 21 Left 922881773 1:228986404-228986426 CCTGTGTCTAAACTGCTTCCTAG No data
Right 922881779 1:228986448-228986470 CTGGAGACCTGCAAATCTGAGGG No data
922881775_922881779 3 Left 922881775 1:228986422-228986444 CCTAGGAGCTCAGTCTGAGAATC No data
Right 922881779 1:228986448-228986470 CTGGAGACCTGCAAATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922881779 Original CRISPR CTGGAGACCTGCAAATCTGA GGG Intergenic
No off target data available for this crispr