ID: 922881800

View in Genome Browser
Species Human (GRCh38)
Location 1:228986579-228986601
Sequence AGCGGGCAGTGCAGTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922881800_922881806 2 Left 922881800 1:228986579-228986601 CCCATCTCACTGCACTGCCCGCT No data
Right 922881806 1:228986604-228986626 TGTGACACTGAGAGCGCAGTGGG No data
922881800_922881805 1 Left 922881800 1:228986579-228986601 CCCATCTCACTGCACTGCCCGCT No data
Right 922881805 1:228986603-228986625 CTGTGACACTGAGAGCGCAGTGG No data
922881800_922881808 28 Left 922881800 1:228986579-228986601 CCCATCTCACTGCACTGCCCGCT No data
Right 922881808 1:228986630-228986652 AGACCCCCAAGAGTCCTGCAGGG No data
922881800_922881807 27 Left 922881800 1:228986579-228986601 CCCATCTCACTGCACTGCCCGCT No data
Right 922881807 1:228986629-228986651 GAGACCCCCAAGAGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922881800 Original CRISPR AGCGGGCAGTGCAGTGAGAT GGG (reversed) Intergenic