ID: 922881801

View in Genome Browser
Species Human (GRCh38)
Location 1:228986580-228986602
Sequence GAGCGGGCAGTGCAGTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922881801_922881805 0 Left 922881801 1:228986580-228986602 CCATCTCACTGCACTGCCCGCTC No data
Right 922881805 1:228986603-228986625 CTGTGACACTGAGAGCGCAGTGG No data
922881801_922881807 26 Left 922881801 1:228986580-228986602 CCATCTCACTGCACTGCCCGCTC No data
Right 922881807 1:228986629-228986651 GAGACCCCCAAGAGTCCTGCAGG No data
922881801_922881806 1 Left 922881801 1:228986580-228986602 CCATCTCACTGCACTGCCCGCTC No data
Right 922881806 1:228986604-228986626 TGTGACACTGAGAGCGCAGTGGG No data
922881801_922881808 27 Left 922881801 1:228986580-228986602 CCATCTCACTGCACTGCCCGCTC No data
Right 922881808 1:228986630-228986652 AGACCCCCAAGAGTCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922881801 Original CRISPR GAGCGGGCAGTGCAGTGAGA TGG (reversed) Intergenic