ID: 922881802

View in Genome Browser
Species Human (GRCh38)
Location 1:228986596-228986618
Sequence GCTCTCAGTGTCACAGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922881802_922881813 19 Left 922881802 1:228986596-228986618 CCCGCTCCTGTGACACTGAGAGC No data
Right 922881813 1:228986638-228986660 AAGAGTCCTGCAGGGCAGACAGG No data
922881802_922881808 11 Left 922881802 1:228986596-228986618 CCCGCTCCTGTGACACTGAGAGC No data
Right 922881808 1:228986630-228986652 AGACCCCCAAGAGTCCTGCAGGG No data
922881802_922881807 10 Left 922881802 1:228986596-228986618 CCCGCTCCTGTGACACTGAGAGC No data
Right 922881807 1:228986629-228986651 GAGACCCCCAAGAGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922881802 Original CRISPR GCTCTCAGTGTCACAGGAGC GGG (reversed) Intergenic