ID: 922881804

View in Genome Browser
Species Human (GRCh38)
Location 1:228986602-228986624
Sequence CACTGCGCTCTCAGTGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922881804_922881813 13 Left 922881804 1:228986602-228986624 CCTGTGACACTGAGAGCGCAGTG No data
Right 922881813 1:228986638-228986660 AAGAGTCCTGCAGGGCAGACAGG No data
922881804_922881808 5 Left 922881804 1:228986602-228986624 CCTGTGACACTGAGAGCGCAGTG No data
Right 922881808 1:228986630-228986652 AGACCCCCAAGAGTCCTGCAGGG No data
922881804_922881807 4 Left 922881804 1:228986602-228986624 CCTGTGACACTGAGAGCGCAGTG No data
Right 922881807 1:228986629-228986651 GAGACCCCCAAGAGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922881804 Original CRISPR CACTGCGCTCTCAGTGTCAC AGG (reversed) Intergenic