ID: 922881805

View in Genome Browser
Species Human (GRCh38)
Location 1:228986603-228986625
Sequence CTGTGACACTGAGAGCGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922881797_922881805 24 Left 922881797 1:228986556-228986578 CCCAAAAGAGTGGAATGGGGAGG No data
Right 922881805 1:228986603-228986625 CTGTGACACTGAGAGCGCAGTGG No data
922881800_922881805 1 Left 922881800 1:228986579-228986601 CCCATCTCACTGCACTGCCCGCT No data
Right 922881805 1:228986603-228986625 CTGTGACACTGAGAGCGCAGTGG No data
922881793_922881805 30 Left 922881793 1:228986550-228986572 CCTTTTCCCAAAAGAGTGGAATG No data
Right 922881805 1:228986603-228986625 CTGTGACACTGAGAGCGCAGTGG No data
922881801_922881805 0 Left 922881801 1:228986580-228986602 CCATCTCACTGCACTGCCCGCTC No data
Right 922881805 1:228986603-228986625 CTGTGACACTGAGAGCGCAGTGG No data
922881799_922881805 23 Left 922881799 1:228986557-228986579 CCAAAAGAGTGGAATGGGGAGGC No data
Right 922881805 1:228986603-228986625 CTGTGACACTGAGAGCGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922881805 Original CRISPR CTGTGACACTGAGAGCGCAG TGG Intergenic