ID: 922881806

View in Genome Browser
Species Human (GRCh38)
Location 1:228986604-228986626
Sequence TGTGACACTGAGAGCGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922881799_922881806 24 Left 922881799 1:228986557-228986579 CCAAAAGAGTGGAATGGGGAGGC No data
Right 922881806 1:228986604-228986626 TGTGACACTGAGAGCGCAGTGGG No data
922881800_922881806 2 Left 922881800 1:228986579-228986601 CCCATCTCACTGCACTGCCCGCT No data
Right 922881806 1:228986604-228986626 TGTGACACTGAGAGCGCAGTGGG No data
922881797_922881806 25 Left 922881797 1:228986556-228986578 CCCAAAAGAGTGGAATGGGGAGG No data
Right 922881806 1:228986604-228986626 TGTGACACTGAGAGCGCAGTGGG No data
922881801_922881806 1 Left 922881801 1:228986580-228986602 CCATCTCACTGCACTGCCCGCTC No data
Right 922881806 1:228986604-228986626 TGTGACACTGAGAGCGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922881806 Original CRISPR TGTGACACTGAGAGCGCAGT GGG Intergenic