ID: 922881808

View in Genome Browser
Species Human (GRCh38)
Location 1:228986630-228986652
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922881803_922881808 10 Left 922881803 1:228986597-228986619 CCGCTCCTGTGACACTGAGAGCG No data
Right 922881808 1:228986630-228986652 AGACCCCCAAGAGTCCTGCAGGG No data
922881800_922881808 28 Left 922881800 1:228986579-228986601 CCCATCTCACTGCACTGCCCGCT No data
Right 922881808 1:228986630-228986652 AGACCCCCAAGAGTCCTGCAGGG No data
922881802_922881808 11 Left 922881802 1:228986596-228986618 CCCGCTCCTGTGACACTGAGAGC No data
Right 922881808 1:228986630-228986652 AGACCCCCAAGAGTCCTGCAGGG No data
922881804_922881808 5 Left 922881804 1:228986602-228986624 CCTGTGACACTGAGAGCGCAGTG No data
Right 922881808 1:228986630-228986652 AGACCCCCAAGAGTCCTGCAGGG No data
922881801_922881808 27 Left 922881801 1:228986580-228986602 CCATCTCACTGCACTGCCCGCTC No data
Right 922881808 1:228986630-228986652 AGACCCCCAAGAGTCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type