ID: 922881813

View in Genome Browser
Species Human (GRCh38)
Location 1:228986638-228986660
Sequence AAGAGTCCTGCAGGGCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922881803_922881813 18 Left 922881803 1:228986597-228986619 CCGCTCCTGTGACACTGAGAGCG No data
Right 922881813 1:228986638-228986660 AAGAGTCCTGCAGGGCAGACAGG No data
922881802_922881813 19 Left 922881802 1:228986596-228986618 CCCGCTCCTGTGACACTGAGAGC No data
Right 922881813 1:228986638-228986660 AAGAGTCCTGCAGGGCAGACAGG No data
922881804_922881813 13 Left 922881804 1:228986602-228986624 CCTGTGACACTGAGAGCGCAGTG No data
Right 922881813 1:228986638-228986660 AAGAGTCCTGCAGGGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922881813 Original CRISPR AAGAGTCCTGCAGGGCAGAC AGG Intergenic