ID: 922882084

View in Genome Browser
Species Human (GRCh38)
Location 1:228988791-228988813
Sequence GAGGGCCTGGTGACCTCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922882074_922882084 13 Left 922882074 1:228988755-228988777 CCACATGCAGGGAGGCTCAGCTG No data
Right 922882084 1:228988791-228988813 GAGGGCCTGGTGACCTCGGCTGG No data
922882073_922882084 14 Left 922882073 1:228988754-228988776 CCCACATGCAGGGAGGCTCAGCT No data
Right 922882084 1:228988791-228988813 GAGGGCCTGGTGACCTCGGCTGG No data
922882066_922882084 28 Left 922882066 1:228988740-228988762 CCCTCATGGTCCCACCCACATGC No data
Right 922882084 1:228988791-228988813 GAGGGCCTGGTGACCTCGGCTGG No data
922882071_922882084 18 Left 922882071 1:228988750-228988772 CCCACCCACATGCAGGGAGGCTC No data
Right 922882084 1:228988791-228988813 GAGGGCCTGGTGACCTCGGCTGG No data
922882067_922882084 27 Left 922882067 1:228988741-228988763 CCTCATGGTCCCACCCACATGCA No data
Right 922882084 1:228988791-228988813 GAGGGCCTGGTGACCTCGGCTGG No data
922882072_922882084 17 Left 922882072 1:228988751-228988773 CCACCCACATGCAGGGAGGCTCA No data
Right 922882084 1:228988791-228988813 GAGGGCCTGGTGACCTCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922882084 Original CRISPR GAGGGCCTGGTGACCTCGGC TGG Intergenic
No off target data available for this crispr