ID: 922882494

View in Genome Browser
Species Human (GRCh38)
Location 1:228991197-228991219
Sequence TATACAACACCCAGTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922882494_922882497 20 Left 922882494 1:228991197-228991219 CCACACCCACTGGGTGTTGTATA No data
Right 922882497 1:228991240-228991262 TGCATGTGCATGCATATGACTGG No data
922882494_922882498 21 Left 922882494 1:228991197-228991219 CCACACCCACTGGGTGTTGTATA No data
Right 922882498 1:228991241-228991263 GCATGTGCATGCATATGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922882494 Original CRISPR TATACAACACCCAGTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr