ID: 922885213

View in Genome Browser
Species Human (GRCh38)
Location 1:229014935-229014957
Sequence GTGGCCTCCCTGGGAAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922885208_922885213 15 Left 922885208 1:229014897-229014919 CCTCACTTTATAGAGTATAAACT No data
Right 922885213 1:229014935-229014957 GTGGCCTCCCTGGGAAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922885213 Original CRISPR GTGGCCTCCCTGGGAAAACT TGG Intergenic
No off target data available for this crispr