ID: 922887194

View in Genome Browser
Species Human (GRCh38)
Location 1:229029181-229029203
Sequence AGGCTGGAGCTCAGCTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922887189_922887194 2 Left 922887189 1:229029156-229029178 CCAGGACTCGGGGCAACTGGGGC No data
Right 922887194 1:229029181-229029203 AGGCTGGAGCTCAGCTCAGAAGG No data
922887180_922887194 28 Left 922887180 1:229029130-229029152 CCCTGAGCTGCAGCTCTGAACTC No data
Right 922887194 1:229029181-229029203 AGGCTGGAGCTCAGCTCAGAAGG No data
922887181_922887194 27 Left 922887181 1:229029131-229029153 CCTGAGCTGCAGCTCTGAACTCT No data
Right 922887194 1:229029181-229029203 AGGCTGGAGCTCAGCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922887194 Original CRISPR AGGCTGGAGCTCAGCTCAGA AGG Intergenic