ID: 922887774

View in Genome Browser
Species Human (GRCh38)
Location 1:229033103-229033125
Sequence GTCCTTGGTAGGGCTTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922887774_922887783 15 Left 922887774 1:229033103-229033125 CCTTGGCAAGCCCTACCAAGGAC No data
Right 922887783 1:229033141-229033163 TGACAGCAGATAATGGGGACAGG No data
922887774_922887780 10 Left 922887774 1:229033103-229033125 CCTTGGCAAGCCCTACCAAGGAC No data
Right 922887780 1:229033136-229033158 TACCCTGACAGCAGATAATGGGG No data
922887774_922887779 9 Left 922887774 1:229033103-229033125 CCTTGGCAAGCCCTACCAAGGAC No data
Right 922887779 1:229033135-229033157 TTACCCTGACAGCAGATAATGGG No data
922887774_922887784 28 Left 922887774 1:229033103-229033125 CCTTGGCAAGCCCTACCAAGGAC No data
Right 922887784 1:229033154-229033176 TGGGGACAGGACTTCCTCTGTGG No data
922887774_922887778 8 Left 922887774 1:229033103-229033125 CCTTGGCAAGCCCTACCAAGGAC No data
Right 922887778 1:229033134-229033156 GTTACCCTGACAGCAGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922887774 Original CRISPR GTCCTTGGTAGGGCTTGCCA AGG (reversed) Intergenic
No off target data available for this crispr