ID: 922888922

View in Genome Browser
Species Human (GRCh38)
Location 1:229045717-229045739
Sequence CTCCAGGTACCTCATATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922888922_922888932 29 Left 922888922 1:229045717-229045739 CCATTTATATGAGGTACCTGGAG No data
Right 922888932 1:229045769-229045791 GGGTTAAGAGGAGGCAGAATGGG No data
922888922_922888929 17 Left 922888922 1:229045717-229045739 CCATTTATATGAGGTACCTGGAG No data
Right 922888929 1:229045757-229045779 AAAGTTGAAAGGGGGTTAAGAGG No data
922888922_922888931 28 Left 922888922 1:229045717-229045739 CCATTTATATGAGGTACCTGGAG No data
Right 922888931 1:229045768-229045790 GGGGTTAAGAGGAGGCAGAATGG No data
922888922_922888926 7 Left 922888922 1:229045717-229045739 CCATTTATATGAGGTACCTGGAG No data
Right 922888926 1:229045747-229045769 ATGCAGATAGAAAGTTGAAAGGG No data
922888922_922888930 20 Left 922888922 1:229045717-229045739 CCATTTATATGAGGTACCTGGAG No data
Right 922888930 1:229045760-229045782 GTTGAAAGGGGGTTAAGAGGAGG No data
922888922_922888933 30 Left 922888922 1:229045717-229045739 CCATTTATATGAGGTACCTGGAG No data
Right 922888933 1:229045770-229045792 GGTTAAGAGGAGGCAGAATGGGG No data
922888922_922888927 8 Left 922888922 1:229045717-229045739 CCATTTATATGAGGTACCTGGAG No data
Right 922888927 1:229045748-229045770 TGCAGATAGAAAGTTGAAAGGGG No data
922888922_922888928 9 Left 922888922 1:229045717-229045739 CCATTTATATGAGGTACCTGGAG No data
Right 922888928 1:229045749-229045771 GCAGATAGAAAGTTGAAAGGGGG No data
922888922_922888925 6 Left 922888922 1:229045717-229045739 CCATTTATATGAGGTACCTGGAG No data
Right 922888925 1:229045746-229045768 AATGCAGATAGAAAGTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922888922 Original CRISPR CTCCAGGTACCTCATATAAA TGG (reversed) Intergenic
No off target data available for this crispr