ID: 922888924

View in Genome Browser
Species Human (GRCh38)
Location 1:229045733-229045755
Sequence TATCTGCATTTGACTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922888924_922888925 -10 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888925 1:229045746-229045768 AATGCAGATAGAAAGTTGAAAGG No data
922888924_922888928 -7 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888928 1:229045749-229045771 GCAGATAGAAAGTTGAAAGGGGG No data
922888924_922888932 13 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888932 1:229045769-229045791 GGGTTAAGAGGAGGCAGAATGGG No data
922888924_922888927 -8 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888927 1:229045748-229045770 TGCAGATAGAAAGTTGAAAGGGG No data
922888924_922888926 -9 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888926 1:229045747-229045769 ATGCAGATAGAAAGTTGAAAGGG No data
922888924_922888931 12 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888931 1:229045768-229045790 GGGGTTAAGAGGAGGCAGAATGG No data
922888924_922888933 14 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888933 1:229045770-229045792 GGTTAAGAGGAGGCAGAATGGGG No data
922888924_922888929 1 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888929 1:229045757-229045779 AAAGTTGAAAGGGGGTTAAGAGG No data
922888924_922888930 4 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888930 1:229045760-229045782 GTTGAAAGGGGGTTAAGAGGAGG No data
922888924_922888934 30 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888934 1:229045786-229045808 AATGGGGAGTTAGTGTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922888924 Original CRISPR TATCTGCATTTGACTCCTCC AGG (reversed) Intergenic
No off target data available for this crispr