ID: 922888928

View in Genome Browser
Species Human (GRCh38)
Location 1:229045749-229045771
Sequence GCAGATAGAAAGTTGAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922888922_922888928 9 Left 922888922 1:229045717-229045739 CCATTTATATGAGGTACCTGGAG No data
Right 922888928 1:229045749-229045771 GCAGATAGAAAGTTGAAAGGGGG No data
922888924_922888928 -7 Left 922888924 1:229045733-229045755 CCTGGAGGAGTCAAATGCAGATA No data
Right 922888928 1:229045749-229045771 GCAGATAGAAAGTTGAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922888928 Original CRISPR GCAGATAGAAAGTTGAAAGG GGG Intergenic
No off target data available for this crispr