ID: 922890364

View in Genome Browser
Species Human (GRCh38)
Location 1:229057492-229057514
Sequence AGGCTGGACCAGCACTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922890364_922890372 15 Left 922890364 1:229057492-229057514 CCCTGAGAGTGCTGGTCCAGCCT No data
Right 922890372 1:229057530-229057552 GGAATCCCACCTGCCTTTCGAGG No data
922890364_922890367 -6 Left 922890364 1:229057492-229057514 CCCTGAGAGTGCTGGTCCAGCCT No data
Right 922890367 1:229057509-229057531 CAGCCTCCGTCCTCACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922890364 Original CRISPR AGGCTGGACCAGCACTCTCA GGG (reversed) Intergenic
No off target data available for this crispr