ID: 922890367

View in Genome Browser
Species Human (GRCh38)
Location 1:229057509-229057531
Sequence CAGCCTCCGTCCTCACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922890364_922890367 -6 Left 922890364 1:229057492-229057514 CCCTGAGAGTGCTGGTCCAGCCT No data
Right 922890367 1:229057509-229057531 CAGCCTCCGTCCTCACCTGCTGG No data
922890365_922890367 -7 Left 922890365 1:229057493-229057515 CCTGAGAGTGCTGGTCCAGCCTC No data
Right 922890367 1:229057509-229057531 CAGCCTCCGTCCTCACCTGCTGG No data
922890362_922890367 7 Left 922890362 1:229057479-229057501 CCACTCGATGGATCCCTGAGAGT No data
Right 922890367 1:229057509-229057531 CAGCCTCCGTCCTCACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922890367 Original CRISPR CAGCCTCCGTCCTCACCTGC TGG Intergenic
No off target data available for this crispr