ID: 922890372

View in Genome Browser
Species Human (GRCh38)
Location 1:229057530-229057552
Sequence GGAATCCCACCTGCCTTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922890368_922890372 -5 Left 922890368 1:229057512-229057534 CCTCCGTCCTCACCTGCTGGAAT No data
Right 922890372 1:229057530-229057552 GGAATCCCACCTGCCTTTCGAGG No data
922890364_922890372 15 Left 922890364 1:229057492-229057514 CCCTGAGAGTGCTGGTCCAGCCT No data
Right 922890372 1:229057530-229057552 GGAATCCCACCTGCCTTTCGAGG No data
922890369_922890372 -8 Left 922890369 1:229057515-229057537 CCGTCCTCACCTGCTGGAATCCC No data
Right 922890372 1:229057530-229057552 GGAATCCCACCTGCCTTTCGAGG No data
922890365_922890372 14 Left 922890365 1:229057493-229057515 CCTGAGAGTGCTGGTCCAGCCTC No data
Right 922890372 1:229057530-229057552 GGAATCCCACCTGCCTTTCGAGG No data
922890366_922890372 -1 Left 922890366 1:229057508-229057530 CCAGCCTCCGTCCTCACCTGCTG No data
Right 922890372 1:229057530-229057552 GGAATCCCACCTGCCTTTCGAGG No data
922890362_922890372 28 Left 922890362 1:229057479-229057501 CCACTCGATGGATCCCTGAGAGT No data
Right 922890372 1:229057530-229057552 GGAATCCCACCTGCCTTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922890372 Original CRISPR GGAATCCCACCTGCCTTTCG AGG Intergenic
No off target data available for this crispr