ID: 922892763

View in Genome Browser
Species Human (GRCh38)
Location 1:229074285-229074307
Sequence GGGCACCCCAGCCCACAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922892755_922892763 23 Left 922892755 1:229074239-229074261 CCTACAGGCAGGAGAGAGCACGT No data
Right 922892763 1:229074285-229074307 GGGCACCCCAGCCCACAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922892763 Original CRISPR GGGCACCCCAGCCCACAGGA GGG Intergenic
No off target data available for this crispr