ID: 922896659

View in Genome Browser
Species Human (GRCh38)
Location 1:229106052-229106074
Sequence CTCCTGTCCTTGAGCCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922896659_922896667 30 Left 922896659 1:229106052-229106074 CCAGTGTGGCTCAAGGACAGGAG No data
Right 922896667 1:229106105-229106127 GTCCAGCCTGTGGGGTTCTCGGG No data
922896659_922896662 20 Left 922896659 1:229106052-229106074 CCAGTGTGGCTCAAGGACAGGAG No data
Right 922896662 1:229106095-229106117 GAAGCCTTCAGTCCAGCCTGTGG No data
922896659_922896661 -8 Left 922896659 1:229106052-229106074 CCAGTGTGGCTCAAGGACAGGAG No data
Right 922896661 1:229106067-229106089 GACAGGAGGTGAATGAAGCAAGG No data
922896659_922896664 22 Left 922896659 1:229106052-229106074 CCAGTGTGGCTCAAGGACAGGAG No data
Right 922896664 1:229106097-229106119 AGCCTTCAGTCCAGCCTGTGGGG No data
922896659_922896666 29 Left 922896659 1:229106052-229106074 CCAGTGTGGCTCAAGGACAGGAG No data
Right 922896666 1:229106104-229106126 AGTCCAGCCTGTGGGGTTCTCGG No data
922896659_922896663 21 Left 922896659 1:229106052-229106074 CCAGTGTGGCTCAAGGACAGGAG No data
Right 922896663 1:229106096-229106118 AAGCCTTCAGTCCAGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922896659 Original CRISPR CTCCTGTCCTTGAGCCACAC TGG (reversed) Intergenic
No off target data available for this crispr