ID: 922897057

View in Genome Browser
Species Human (GRCh38)
Location 1:229108689-229108711
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922897057_922897059 -4 Left 922897057 1:229108689-229108711 CCTGCACAGTGCACACCAGCACC No data
Right 922897059 1:229108708-229108730 CACCAGCCCTCACCAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922897057 Original CRISPR GGTGCTGGTGTGCACTGTGC AGG (reversed) Intergenic
No off target data available for this crispr