ID: 922898529

View in Genome Browser
Species Human (GRCh38)
Location 1:229118997-229119019
Sequence CTGGGGACCCAGAGCTCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922898521_922898529 13 Left 922898521 1:229118961-229118983 CCTCTGGTCAGAACCAGGAGGAG No data
Right 922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG No data
922898517_922898529 30 Left 922898517 1:229118944-229118966 CCTGCTCTGCTCAGTGGCCTCTG No data
Right 922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG No data
922898524_922898529 0 Left 922898524 1:229118974-229118996 CCAGGAGGAGAGGTGGAGACTTC No data
Right 922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922898529 Original CRISPR CTGGGGACCCAGAGCTCACA AGG Intergenic
No off target data available for this crispr