ID: 922899143

View in Genome Browser
Species Human (GRCh38)
Location 1:229122907-229122929
Sequence ATTCCTGCCTTGCTGCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922899137_922899143 12 Left 922899137 1:229122872-229122894 CCCCAACAGAGGTCATGGTCCTG No data
Right 922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG No data
922899134_922899143 24 Left 922899134 1:229122860-229122882 CCAGCATCTGCTCCCCAACAGAG No data
Right 922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG No data
922899140_922899143 -7 Left 922899140 1:229122891-229122913 CCTGCCTCCACGATGCATTCCTG No data
Right 922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG No data
922899138_922899143 11 Left 922899138 1:229122873-229122895 CCCAACAGAGGTCATGGTCCTGC No data
Right 922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG No data
922899139_922899143 10 Left 922899139 1:229122874-229122896 CCAACAGAGGTCATGGTCCTGCC No data
Right 922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922899143 Original CRISPR ATTCCTGCCTTGCTGCTGAG TGG Intergenic
No off target data available for this crispr